Should you and your family be tested for genetic conditions that can cause blood clots?  After you have had a pulmonary embolism or DVT (deep vein thrombosis) you may think that the answer is an easy, “YES!”  It isn’t.  Genetic testing comes at a price.  You need to know what that price is and if you are willing to pay it.  You also need to know if you are willing to make that decision for your children and other family members.  Get ready for a quick ride through genetics, genetic testing, and the dark side of testing for genetic blood clotting conditions.

Blood clotting conditions raise the risk of forming blood clots in the lungs (pulmonary embolism) or in the large veins in your body (deep vein thrombosis).  These clots can be very serious and often have a lengthy recovery period.  Sometimes these clots are fatal. 
We can break clotting conditions into two general groups: genetic and non-genetic.  Genetic clotting conditions come from one of your parents by way of the genes that were carried in an egg or sperm cell when you were conceived.  Non-genetic clotting conditions do not come from your parents.  These can come from things like cancer, other diseases, or things that we haven’t discovered yet.  We are going to focus on the first group, clotting conditions that are caused by genetics.

When you were conceived you received genetic material from your mother and father.  For instance, I have blue eyes.  I have one gene for blue eyes from my mother and one gene for blue eyes from my father.  I also have a clotting condition called Factor V Leiden.  I have one good copy of the Factor V Leiden gene.  It came from my mother.  I also have one mutated gene from my father.  (We will come back to this a little later.)

Your DNA looks a bit like a spring shaped ladder.  It is made up of 4 chemicals that we typically refer to in an abbreviated form: A, G, T, and C.  Each ladder rung has a pair of letter with one side from mom and the other side from dad.  Each ladder rung is responsible for an instruction about who and what you are.  Scientists have mapped out these ladder rungs.  Each step is a location and each location has certain patterns of A, G, T, C that are acceptable.  If just one of those letters is off, your genetic code has a “mutation”.  Mutations may do something small like change your hair color.  Unfortunately, mutations can also do something more serious like impacting how your blood clots.  These blood clotting mutations are what doctors are looking for when they run tests for genetic blood clotting conditions.

Genetic testing takes some material from your body, pulls out the DNA, and then looks at certain sections of that DNA to see if it has the correct chemicals in the correct places. For example, one wrong letter in this section of DNA causes Factor V Leiden: GCAAGAACTGCAGGGGAGGAGGACGCTGCCACCCACAGCCTCTAGAGCTCATTGCAGCTGGGACAGCCCGGAGTGTGGTTATGTTTGGGCTATTATCTAATGCTGTGTAGAAATATTAAAACCCCTGTTATTTTGAAATAAAAAAGATACCCACTTTT.  A DNA test scans for mistakes and uses them to identify any clotting conditions.

DNA testing has a number of benefits.  First, these tests are very accurate because your DNA never changes.  You get your DNA at conception and you have the same DNA throughout every cell in your body your entire life.  Blood clots and anticoagulation will not change your DNA. Second, DNA tests may also help other family members understand any increased blood clots risks.  As DNA is passed through parents to offspring you can figure out who should watch carefully for clots without having them tested.  Lastly, DNA testing can be done before something goes wrong.  Your doctor can test you and warn you of potential health issues before they happen.  This gives you a chance to avoid problems that faulty DNA may cause.

So, if DNA testing is so useful, why am I writing an article about the dark side of genetic testing?  Knowing your DNA comes at a cost.  You may learn that you or your family member has an incurable condition.  You may pay for a test that doesn’t matter because the disease never would have showed up in that person. (Factor V Leiden only has a 1 in 10 chance of causing a clot!).  DNA testing may cause unneeded fear and stress.  Low risk clotting conditions typically are not medicated as the medication is higher risk than the chance of serious illness from a clot.  Someone may end up taking unneeded medication and have serious side effects.  Medical treatment after genetic testing isn’t always clear.

Health isn’t the only risk with DNA testing.  There is another very large and very real risk with genetic testing, discrimination.  In 2008 the Genetic Discrimination Nondiscrimination Act (GINA) was enacted to protect Americans from job and medical insurance discrimination from results of genetic testing.  GINA ensures that health insurance companies cannot ask you about any DNA testing or any DNA test results when you apply for insurance.  GINA also states that employers may not ask for the results of DNA testing when making hiring or promotion decisions.  GINA is a good start but there are still many places that can discriminate based on genetic test results.

Genetic discrimination can still be found in many places.  Life insurance, annuities, banks, home insurance, travel insurance, and disability insurance can all review the results of past DNA testing before determining eligibility.  It doesn’t matter when the testing occurred.  A parent may have a 6-year-old child tested for genetic clotting conditions.  When the child is 46 that genetic information may still disqualify him or her from participating in certain services.  Your DNA never changes so the results of a DNA test will follow you forever, even if you were not the person that decided to have the test done.  Another place discrimination shows up is in subconscious discrimination.  A possible date might turn a woman down to blood clot risks in pregnancy.  You may be passed over for a job after your workplace hears about your results because your boss is subconsciously concerned that stress may cause clots.  Some of these forms of discrimination are obvious, some are not.  They all share one thing in common: they are a result of a DNA test.
DNA testing is often used when blood clots occur.  DNA testing can help you to determine your treatment.  It can also help family members avoid future clots.  The problem is that genetic testing, like all medical procedures, should be weighed carefully.  Some people want to have all of their children and close family members tested.  I recommend talking to different doctors before jumping into family blood testing.  If the blood testing will have a significant impact in medical treatment it may be warranted.  On the other hand, if the DNA test is being used as nothing more than a precaution, you may decide that your own clotting history is enough precaution on its own.  Ask your doctor how treatment will change based on the DNA test results.  The social and monetary costs must be determined and considered.

Back to my story...
After my clots in 2008 we decided not to have my parents tested.  As a family we did inform other family members of my medical history and Factor V Leiden diagnosis so that they could be on the lookout for clots and could enact clot prevention strategies.  Since then both of my parents had surgery.  While the doctor didn’t require it, they chose to have Factor V Leiden testing.  My dad was my gene donor.  It didn’t change their surgeries much.  My mom who does not have Factor V Leiden was given pressure cuffs and anticoagulation as she had a high risk surgery.  My dad’s surgery was much less serious and had the pressure cuffs while in surgery.  Thankfully, neither clotted.

For more information about genetic testing I highly recommend an episode of Neil DeGrasse Tyson’s podcast called Star Talk.  Season 7, episode 9 is titled The Promise and Peril of the Genomic Revolution.  It features one of the founders of 23 and Me and discusses the morality and future of genetic testing.  This episode can be found here: https://soundcloud.com/startalk/the-promise-and-peril-of-the-genomic-revolution or you can listen to it below.

Did you know that your brain is trying to prevent you from receiving the best medical care for your blood clot or clotting condition?  Your brain is faced with an uncountable amount of information every day.  In order to process all of this information the human brain has developed rules and ways of thinking to allow it to quickly sort, process, and act on massive amounts of data.  While our brains do a miraculous job handling this data they also can lead us to false conclusions that can slow our healing and put us at a greater risk for significant health problems in the future.  In today’s article we are going to review how the brain processes information and look at some of the most common errors in thinking that may negatively affect your medical care.

Humans make mistakes in thinking due to how the brain handles information.  The name for these errors is cognitive bias.  Research has shown that learning about cognitive biases can help you make better decisions.  Better decisions will lead to better healthcare, faster healing, and a lowered risk of future clots.

Recency effect
Have you found yourself looking back into the days and weeks before your clot to try to figure out what caused it?  Be careful, you may find your brain suffering from the recency effect.  Our brains tend to look at how close together two things happened in time.  The more recently something happened the more likely we are to think that it was the cause.  Maybe you ran a marathon, started a new medication, or took a supplement in the days leading up to your blood clot.  While these might be the cause of your clot it is also possible that genetics, pregnancy, or other long term risk factors were the cause of your clot.  It is also possible that your clot was caused by multiple risk factors rather than a solitary event.  It is important for you and your medical tem to evaluate all of your risks rather than the ones that may have just happened.

Confirmation bias
Did you jump on the Internet to see what caused your clot?  Be careful, we tend to favor information that supports what we already believe.  Humans have a difficult time believing evidence that tells them what they think is wrong.  Let’s look at an example.  Sally has a blood clot and her doctor puts her on warfarin, an anticoagulant.  Sally knows that warfarin is also used as rat poison so she is very uncomfortable with this medication.  She goes to the Internet to read about warfarin.  She reads five articles that state that warfarin is safe and one article that states warfarin is dangerous.  Sally favors the one article that states that warfarin is dangerous because it supports what she already believed.  She goes to her doctor and asks to switch medications.  The human brain doesn’t like to be wrong.  When doing research it is a good idea to try to prove yourself wrong rather than right.

Faulty generalization
Looking at other people’s experiences can be comforting but it can also cause errors in thinking.  Human brains tend to over estimate how many times something happens.  We often think that if we meet one person that had something happen this must be true for everyone.  Here are some examples. 

Sam’s mother died of a brain bleed while taking a newer anticoagulant.  Bob’s mother takes warfarin and has no side effects.  This must mean that warfarin is safer.  In reality some of the newer anticoagulants have a much lower risk of brain bleeds.  In this example I don’t pay attention to the fact that I need to look at thousands if not millions of examples to know which medication is safer.  One example does not tell me how other people overall react to a medication.  This is why we need thousands of people in drug studies.

Mary had a blood clot while on birth control.  It must be very dangerous.  Again I am looking at just one person.  I did not consider the millions of people who didn’t have a clot on birth control.  Pregnancy is a larger risk factor than birth control.  I missed that information though because I only focused on my friend Mary.

To overcome this error in thinking make sure to read studies that look at thousands of people.  Ask your doctor for advice about medications.  Doctors are trained to read medical papers and understand risk factors.  It is a good idea to ask your doctor why he or she favors a treatment or preventative measure.  Feel free to ask for the research so that you can be confident that your healthcare decision is based on the full picture rather than just one or two people.  Be careful on support groups.  They are a great resource but make sure that you aren’t taking a few people’s experiences and favoring them over well researched information.  Just because it happened to one person doesn't mean that it will happen to you.

Negativity bias
We tend to pay more attention to bad news versus good news.  When we see a lawyer add on television for malpractice we believe that this is happening everywhere and we can’t trust the medical community.  We hear about blood clots or bleeds being associated with treatments and we don’t see the millions of people who benefit from these treatments.  We hear about people who struggle to recovery from a pulmonary embolism and don’t see those who heal in two weeks.  We see our own misery and don’t see that we can ever heal.  I recommend that you try to intentionally focus on the positives.  Keep a list of five good things that happen a day.  Chart your progress that you make in recovery on a daily or weekly basis.  Pay attention to those people in support groups who are thriving.  These will lighten your heart and help you to avoid the negativity bias.

Wrong authority
We don’t do a good job knowing who to trust.  We may find advertisements and peers better sources of information than our doctors.  Make sure that you use your medical team as your main source of information.  It can be difficult to know which articles online can be trusted.  If you want to read more on a topic you can visit a library and ask the librarian for help in finding information from reliable sources.  If you happen to have a medical school near you then take advantage of it!  It will have a medical library with a trained medical librarian.

If you struggle with trusting your doctor try these ideas:

1. Ask questions until you know why your doctor feels a certain diagnosis or treatment is correct
2. Ask why NOT the alternate diagnosis or treatment
3. Seek second opinions from other doctors
4. Ask your pharmacist
5. Find a support group or questions and answer service that is staffed by doctors
6. Ask different types of doctors and have a variety of doctors on your team (OBGYN, GP, internist, hematologist, radiologist, pulmonologist)
7. Consult sites that are written for doctors by professional organizations
8. Use sites that end in .gov or .edu for your research
9. Get a doctor that you trust

How to overcome biases in thought

1. Look for research that disproves your belief and seriously consider it.
2. Don’t take one person’s story and use it as the basis for your treatment.  Use professional research and the opinion of your medical treatment team as the basis of your treatment decisions.
3. Make sure to take note of the positives as well as the negatives.
4. Don’t panic when you hear lawyer ads.  You can use them as a sign you should research something more.  Do not assume that because there is a malpractice ad that there really is a huge problem with a treatment.
5. Look at research statistics not individual experiences.
6. Use reliable sources.  Many end in .edu or .gov.  A librarian can also point you towards reliable places to get information.
7. Find professional organizations that deal in clots.  The Clot Spot has a great list of these in the resources section.
8. Don’t panic!

Activity trackers can be amazingly useful in pulmonary embolism recovery.  Many of them are able to track the amount, time of, and frequency of activity throughout the day.  This tracking is automatic and easy.  When I was in recovery I was tracking some of this information by hand.  Now there are sleek little gadgets to do the work for you.

Activity trackers are small wearable devices that track the wearer's movements throughout the day.  They are similar to a pedometer but they are able to track more than just steps.  They are very easy to use.  Charge the battery, wear the tracker, and sync it with your phone or computer.

I have long been an advocate of tracking your recovery.  I found that logging data allowed me to see my own growth as a progressed through recovery.  I had my pulmonary embolism in 2008.  There were no activity trackers available.  I took walks that I timed, used a pedometer to count my steps, used a heart rate monitor watch, and measured my blood pressure.  Each of these measurements was hand tracked in a paper notebook.

The Fit Bit One is one of the many activity trackers on the market.  I bought one a few weeks ago after seeing family members with them at a family reunion.  My goal for my Fit Bit was simply to move more.  I have just started a work at home job and I know that it will be easy to gain weight.  As I have worn my Fit Bit One I have realized that it has a lot of potential in pulmonary embolism recovery and in the prevention of blood clots.  I am going to share some of the features of the Fit Bit One with you.  While I own a Fit Bit One, I know that other activity trackers have similar features.  I will share some of the other brands and the end of this article.

One of the best things about the Fit Bit One is that it is tiny and unobtrusive.  In my picture you can see my Fit Bit inside of its rubber clip case.  I wear it clipped to my bra.  You can't even tell that it is on when I wear it.  If you don't want it on your bra, or if you are a guy, you can wear it clipped on your pants waistband.  Fit Bit and other brands also offer models that can be worn as a bracelet.

Activity trackers often have the ability to track steps, calories burned, exercise activities, floors climbed, calories consumed, and sleep patterns.  Activity trackers also record time.  This lets you see when you were active and how active you were at times throughout the day.  (Check the specific models to see which of these features are available.)  Most activity trackers, like my Fit Bit One, sync with a smart phone and computer so that all of the tracking data can be stored, analyzed, and compared.  These features make activity trackers very useful for pulmonary embolism survivors.

Activity trackers are very useful in pulmonary embolism recovery because of their ability to automatically track and record data over time.  Many of the new trackers don't even need a cable to sync with your smart phone or computer; they just automatically connect over a wireless connection as you go about your day.  This means that all you have to do is make sure that you have your tracker on.  As long as it is on, you are good to go.

Pulmonary embolism survivors can wear an activity tracker during recovery to track improvements in activity level.  My Fit Bit One sends me an email once a week with updates on my stats.  It gives me a little arrow to show me if I have improved that statistic from the previous week.  I can also go through my days one at a time on the Fit Bit website and or flip through my data throughout the day on either my iPhone or Fit Bit One.  Data is a great way to get an unbiased snapshot of recovery.  The more stamina that you have, the more steps you will walk in a day.  These numbers should improve throughout recovery.  

You can also use this data to set recovery goals for yourself.  Fit  Bit and other trackers allow you to set personal activity goals.  I started my Fit Bit One journey at 2,000 steps a day.  It took a while to get that number every week.  I then upped it to 2,500 steps a day.  You can set goals for any of the things that Fit Bit measures (calories, floors climbed, active minutes, and etc.). 

Another use for an activity tracker is to monitor weight during recovery and to assist in weight loss.  Weight loss decreases the risk of future clots and is a common recommendation from the medical community.  Fit Bit is able to track the calories that I eat and the calories that I am expending.  I can set calorie goals based on my weight loss needs.

I got my Fit Bit One to help me to increase my activity levels and to assist in weight management.  As I have worn my Fit Bit One I have realized that it is helping me to monitor my movement throughout the day.  Weight loss and movement are two of the most effective pulmonary embolism preventatives.  My activity monitor is assisting with both of these preventatives.  I knew that my Fit Bit would help me to track calories.  What I didn't realize was how useful its data logging is in my own pulmonary embolism prevention quest.

If you look at my Fit Bit dashboard you will see the graph in the upper left hand corner.  This shows me the hours of the day on the bottom and then puts a line in whenever I walk throughout the day.  i can also look at the floors that I climb or the calories that I burn.  This lets me check myself to see if I am getting up enough throughout the day.  You can see that on this day I didn't walk much after 6 PM or before 10:00 AM.  The later steps were likely missing because I looked at my computer around 5 or 6 PM.  The morning appears to have been largely inactive.  This tells me that I need to review my activity throughout the day to ensure that I am moving.  Individuals with a history of pulmonary embolism should move at least once every two hours.  My Fit Bit keeps an eye on me and lets me know when I am not doing this well.

(Different activity monitors will handle their data in different ways.  Many are able to sync with a computer and a smartphone.  Make sure to check the models out though as some only store data on the unit.  I believe that the computer tracking that you see above is vital for a pulmonary embolism survivor.  I highly recommend that you pick out a tracker that is able to hook up with a smart phone and/or a computer.)

Throughout the day when I am not at my computer I use my iPhone to check on my progress.  I can look at my Fit Bit but it doesn't give me as much data and I wear it clipped to my bra so I can't see it in public.  The FitBit uses bluetooth to automatically update my iPhone as the day passes.  While you dot have to have a phone to use it, it comes with a USB dongle to sync with a computer, I love that I don't have to think about it when it is set up with my iPhone.

Each of these lines can be tapped.  When you tap the specific type of data, a chart comes up with a timeline.  Like the computer program you are able to see how that measurement varied throughout the day.  I find that simply watching steps to see when I have moved helps me to track myself.  I work at home and making sure that I am moving throughout the day is important.  This bit of feedback let's me know if I need to modify my habits.

Many supplements interact with anticoagulants.  These reactions may make the medications less effective or may increase the risk of bleeding.  This post has links to places where you can get information on drug/natural supplement interactions.  Make sure to check for interactions, talk to your pharmacist, and talk with your doctor before adding or removing supplements from your treatment plan.  This will help you prepare for possible problems.

From Health Notes:

• Warfarin (Coumadin)
• Lovenox
• Heparin
• Xarelto

Other reliable references:

• The Mayo Clinic
• Medline Plus

Today, we will learn about some of the risks of natural medications and supplements.  Before we get to that topic, I want to review the answers to the questions that I posted in the last entry.  Let's review the different mystery substances:

Substance #1 is warfarin (coumadin).
This substance was discovered when a farmer noticed his cows were bleeding more than a healthy cow should bleed.  He did some research and found out that the cows had consumed a large amount of a certain plant while munching the grass in their pasture.  This natural substance is very effective at preventing clots and is still used for this purpose to this day.

Substance #2 is water.
This substance is fine when taken in certain amounts.  It is very effective in preventing clots and often recommended by doctors.  If the patient takes too much of this substance he or she will suffer muscle contractions, headache, seizures, nausea, and unresponsiveness.  If this overdose is not addressed, it will lead to coma and death.

Substance #3 is aspirin.
This substance is starting to show promise as a means to prevent pulmonary embolism.  Although the research is conflicting, some doctors are recommending that patients use this substance.  This substance increases the risk of fatal bleeding.  Other side effects of this substance include vomiting, stomach pain, hives, rash, facial swelling, difficulty breathing, fast heart rate, fast breathing, clammy skin, loss of hearing, and death.

As you can see, anything that you put into your body can have side effects.  It doesn't matter if the substance is over the counter or if it is a prescription.  As a patient it is important to read the labels and talk to medical professionals.  For natural substances you will need to dig a little deeper to find information.  It is much more difficult to find the side effects profile of natural supplements.  When the information does show up, it is even more difficult to know if you can trust the source.

Some Supplements Are Dangerous
Although many sources will tell you that supplements have no side effects because they are not medicine, this is not the case.  Supplements are medicine and they do have side effects.  In the last two weeks articles have come out about the dangers of some very common supplements.  I wanted to share this information because the dangerous supplements are often used by blood clot patients.

Fish Oil May Cause Bleeding And May Increase The Risk Of Aggressive Prostate Cancer
While we often hear that omega fatty acids are healthy, research is beginning to show that they may only be healthy when they are consumed as fish rather than fish oil.  The UK Daily Mail  reported on July 10, 2013, that omega-3 fatty acid fish oil supplements may increase the risk of aggressive prostate cancer by 70%.  Aggressive prostate cancer is fairly rare, however, if you are male, you may wish to reconsider using fish oil as a post clot preventative.  Another problem with fish oil is that it does not mix well with anticoagulation therapy (blood thinners).  If you are on anticoagulation therapy, fish oil raises the risk of suffering a major bleed.

Supplements That Increase The Risk Of Bleeding
Supplements can change how the liver creates and processes blood clotting enzymes, change ow much vitamin K is in the body, reduce platelet counts, or decrease thrombin effectiveness.  All of these effects can increase the risk of bleeding, especially if you are on anticoagulation therapy.  In 2010 a study of 100 common herbal remedies was conducted.  It found that 69 out of 100 of the remedies affected how warfarin worked in the body.  If you are on anticoagulation please talk with your pharmacist and physician about mixing herbs and supplements with warfarin.  Here are some of the most common natural supplements that significiantly raise the risk of bleeding and of requiring a blood transfusion:

• Ginko Biloba
• Ginsing
• Garlic
• Fish Oil
• Dong Quai
• Feverfew
• Chamomile
• Ginger
• Nettle
• Cayenne Pepper
• Bromelain

References:
Macrae, F. (2013, July 10). Taking omega-3 fish oil supplements may increase the risk of aggressive prostate cancer by 70%. Mail Online. Retrieved July 17, 2013, from http://www.dailymail.co.uk/health/article-2359466/Taking-omega-3-fish-oil-supplements-increase-risk-aggressive-prostate-cancer-70.html

Story, C. (2013, July 10). Could the Herbs You’re Taking Cause Life-Threatening Bleeding? Renegade Health. Retrieved July 17, 2013, from http://renegadehealth.com/blog/2013/07/10/could-the-herbs-youre-taking-cause-life-threatening-bleeding

U.S. National Library of Medicine. (2012, July 23). Fish oil: MedlinePlus Supplements. MedlinePlus. Retrieved June 3, 2013, from http://www.nlm.nih.gov/medlineplus/druginfo/natural/993.html

Student teaching is over and I am finally getting back to this website.  I want to start by taking a moment to welcome all of the new Clot Spot readers.  Today I want to talk about a new article that was just added to The Clot Spot.  Today I wrote a lengthy post on natural alternatives to warfarin.  It can be found here.  I wrote this article because this is something that feel very strongly about.  I use natural medicine for my migraines under supervision of my doctor.  The supplements were carefully chosen and well researched.  I take them, not because I am afraid of pharmaceutical preventatives, but because those preventatives simply did not work for me.  Before I started taking them, I did a lot of research.  I wanted to know what side effects might occur due to these supplements.  After understanding my risks, I started the supplements.  

I strongly encourage all of you to do this research for both pharmaceutical and natural treatments.  Some natural treatments are more harmful than you can imagine.  There are no requirements for supplement companies to run a disclaimer on their ads or their bottles.  These companies even try to market supplements as a "drug free" alternative.  Natural supplements are drugs.  They have side effects.

I have chosen not to use supplements that will change how my blood clots.  Some of you may choose a different path.  I do not trust my blood to unregulated supplements.  Many of us struggle with different brands of warfarin and those variations are less than 4%!  If 4% bothers your body, imagine what an unregulated variation may do to your body.  Bleeding and clotting are important.  I want to know how much of a substance is in me.  Those natural supplements are chemicals and I want to have them carefully controlled.  I do not want to bleed to death or clot due to variations in dosage.  Also, I want a medication that is well tested.  

Recently, I read an interesting article on this topic at Slate.  I highly recommend it.  It got me thinking a lot about our fear of "chemicals" and "drugs".  

With that article and my recent addition to The Clot Spot, I want to play a guessing game.  I will describe three common substances that can be used to prevent clots; you will guess what they are.  Please leave your guesses in the comments.

Ready?

Substance #1:
This substance was discovered when a farmer noticed his cows were bleeding more than a healthy cow should bleed.  He did some research and found out that the cows had consumed a large amount of a certain plant while munching the grass in their pasture.  This natural substance is very effective at preventing clots and is still used for this purpose to this day.

Substance #2
This substance is fine when taken in certain amounts.  It is very effective in preventing clots and often recommended by doctors.  If the patient takes too much of this substance he or she will suffer muscle contractions, headache, seizures, nausea, and unresponsiveness.  If this overdose is not addressed, it will lead to coma and death.

Substance #3
This substance is starting to show promise as a means to prevent pulmonary embolism.  Although the research is conflicting, some doctors are recommending that patients use this substance.  This substance increases the risk of fatal bleeding.  Other side effects of this substance include vomiting, stomach pain, hives, rash, facial swelling, difficulty breathing, fast heart rate, fast breathing, clammy skin, loss of hearing, and death.

I will be back on to share the answers in a few days.