Should you and your family be tested for genetic conditions that can cause blood clots?  After you have had a pulmonary embolism or DVT (deep vein thrombosis) you may think that the answer is an easy, “YES!”  It isn’t.  Genetic testing comes at a price.  You need to know what that price is and if you are willing to pay it.  You also need to know if you are willing to make that decision for your children and other family members.  Get ready for a quick ride through genetics, genetic testing, and the dark side of testing for genetic blood clotting conditions.

Blood clotting conditions raise the risk of forming blood clots in the lungs (pulmonary embolism) or in the large veins in your body (deep vein thrombosis).  These clots can be very serious and often have a lengthy recovery period.  Sometimes these clots are fatal. 
We can break clotting conditions into two general groups: genetic and non-genetic.  Genetic clotting conditions come from one of your parents by way of the genes that were carried in an egg or sperm cell when you were conceived.  Non-genetic clotting conditions do not come from your parents.  These can come from things like cancer, other diseases, or things that we haven’t discovered yet.  We are going to focus on the first group, clotting conditions that are caused by genetics.

When you were conceived you received genetic material from your mother and father.  For instance, I have blue eyes.  I have one gene for blue eyes from my mother and one gene for blue eyes from my father.  I also have a clotting condition called Factor V Leiden.  I have one good copy of the Factor V Leiden gene.  It came from my mother.  I also have one mutated gene from my father.  (We will come back to this a little later.)

Your DNA looks a bit like a spring shaped ladder.  It is made up of 4 chemicals that we typically refer to in an abbreviated form: A, G, T, and C.  Each ladder rung has a pair of letter with one side from mom and the other side from dad.  Each ladder rung is responsible for an instruction about who and what you are.  Scientists have mapped out these ladder rungs.  Each step is a location and each location has certain patterns of A, G, T, C that are acceptable.  If just one of those letters is off, your genetic code has a “mutation”.  Mutations may do something small like change your hair color.  Unfortunately, mutations can also do something more serious like impacting how your blood clots.  These blood clotting mutations are what doctors are looking for when they run tests for genetic blood clotting conditions.

Genetic testing takes some material from your body, pulls out the DNA, and then looks at certain sections of that DNA to see if it has the correct chemicals in the correct places. For example, one wrong letter in this section of DNA causes Factor V Leiden: GCAAGAACTGCAGGGGAGGAGGACGCTGCCACCCACAGCCTCTAGAGCTCATTGCAGCTGGGACAGCCCGGAGTGTGGTTATGTTTGGGCTATTATCTAATGCTGTGTAGAAATATTAAAACCCCTGTTATTTTGAAATAAAAAAGATACCCACTTTT.  A DNA test scans for mistakes and uses them to identify any clotting conditions.

DNA testing has a number of benefits.  First, these tests are very accurate because your DNA never changes.  You get your DNA at conception and you have the same DNA throughout every cell in your body your entire life.  Blood clots and anticoagulation will not change your DNA. Second, DNA tests may also help other family members understand any increased blood clots risks.  As DNA is passed through parents to offspring you can figure out who should watch carefully for clots without having them tested.  Lastly, DNA testing can be done before something goes wrong.  Your doctor can test you and warn you of potential health issues before they happen.  This gives you a chance to avoid problems that faulty DNA may cause.

So, if DNA testing is so useful, why am I writing an article about the dark side of genetic testing?  Knowing your DNA comes at a cost.  You may learn that you or your family member has an incurable condition.  You may pay for a test that doesn’t matter because the disease never would have showed up in that person. (Factor V Leiden only has a 1 in 10 chance of causing a clot!).  DNA testing may cause unneeded fear and stress.  Low risk clotting conditions typically are not medicated as the medication is higher risk than the chance of serious illness from a clot.  Someone may end up taking unneeded medication and have serious side effects.  Medical treatment after genetic testing isn’t always clear.

Health isn’t the only risk with DNA testing.  There is another very large and very real risk with genetic testing, discrimination.  In 2008 the Genetic Discrimination Nondiscrimination Act (GINA) was enacted to protect Americans from job and medical insurance discrimination from results of genetic testing.  GINA ensures that health insurance companies cannot ask you about any DNA testing or any DNA test results when you apply for insurance.  GINA also states that employers may not ask for the results of DNA testing when making hiring or promotion decisions.  GINA is a good start but there are still many places that can discriminate based on genetic test results.

Genetic discrimination can still be found in many places.  Life insurance, annuities, banks, home insurance, travel insurance, and disability insurance can all review the results of past DNA testing before determining eligibility.  It doesn’t matter when the testing occurred.  A parent may have a 6-year-old child tested for genetic clotting conditions.  When the child is 46 that genetic information may still disqualify him or her from participating in certain services.  Your DNA never changes so the results of a DNA test will follow you forever, even if you were not the person that decided to have the test done.  Another place discrimination shows up is in subconscious discrimination.  A possible date might turn a woman down to blood clot risks in pregnancy.  You may be passed over for a job after your workplace hears about your results because your boss is subconsciously concerned that stress may cause clots.  Some of these forms of discrimination are obvious, some are not.  They all share one thing in common: they are a result of a DNA test.
DNA testing is often used when blood clots occur.  DNA testing can help you to determine your treatment.  It can also help family members avoid future clots.  The problem is that genetic testing, like all medical procedures, should be weighed carefully.  Some people want to have all of their children and close family members tested.  I recommend talking to different doctors before jumping into family blood testing.  If the blood testing will have a significant impact in medical treatment it may be warranted.  On the other hand, if the DNA test is being used as nothing more than a precaution, you may decide that your own clotting history is enough precaution on its own.  Ask your doctor how treatment will change based on the DNA test results.  The social and monetary costs must be determined and considered.

Back to my story...
After my clots in 2008 we decided not to have my parents tested.  As a family we did inform other family members of my medical history and Factor V Leiden diagnosis so that they could be on the lookout for clots and could enact clot prevention strategies.  Since then both of my parents had surgery.  While the doctor didn’t require it, they chose to have Factor V Leiden testing.  My dad was my gene donor.  It didn’t change their surgeries much.  My mom who does not have Factor V Leiden was given pressure cuffs and anticoagulation as she had a high risk surgery.  My dad’s surgery was much less serious and had the pressure cuffs while in surgery.  Thankfully, neither clotted.

For more information about genetic testing I highly recommend an episode of Neil DeGrasse Tyson’s podcast called Star Talk.  Season 7, episode 9 is titled The Promise and Peril of the Genomic Revolution.  It features one of the founders of 23 and Me and discusses the morality and future of genetic testing.  This episode can be found here: https://soundcloud.com/startalk/the-promise-and-peril-of-the-genomic-revolution or you can listen to it below.

After a blood clot, tests can be run to determine if you have a condition that makes your blood clot more easily than the majority of the population.  These conditions are often referred to as clotting conditions, thrombophilia, or hypercoagulable states.  Testing for these conditions will not be able to predict who will and will not have a clot.  About half of the people who have a clot will have no known cause.  This means that the blood work would show no clotting conditions.

Testing for thrombophilia is useful when deciding the length of time a patient will be on anticoagulants.  The problem with anticoagulants is that they are risky.  You only want to be on anticoagulants if the risk of clotting is larger than the risk of a life threatening bleed.  Testing for thrombophilia will give you more information so that you and your doctor can determine which risk is more acceptable for you.

To determine if thrombophilia testing is right for you, you should:

• Ask your doctor if having thrombophilia would change his or her recommendations about the amount of time that you will take anticoagulant medications.  If the test will not change treatment, the test is not needed.
• Talk with your doctor and insurance agents about the impact the findings may have on your ability to obtain life insurance.
• Consider your age.  Many recommendations state that individuals under the age of 50 that had a DVT or PE without a significantly large risk factor (abdominal surgery, bed ridden, cancer, or other major risks) have tests run to see what may have caused the clot.
• Consider your risks.  Can you and your doctor identify any MAJOR risks?  A major risk may be able to be eliminated so that the clot doesn't repeat.  If you only had a minor risk (weight and birth control are examples) there is a good chance that something else contributed to your clot.
• Ask your medical team what they feel are typical, minor, and major risks for blood clots and figure out where you fit into that list.
• Consider what risks will be in your future.  Are you thinking about birth control, infertility treatments, cancer, hormone replacement, frequent long haul airplane trips, or any other big risks?  You may want to know if you have a clotting condition that will put you at further risk.
• Is there a family history of clotting or miscarriage?  If there is, let your doctors know!
  

Think about your history, the costs, risks, and benefits.  Medical testing seems harmless but it can have unwanted effects.  If you need help deciding about testing please talk to your primary care provider and consider requesting a hematology consult.  Feel free to get a second opinion.  Many times doctors will write off a clot as a simple case of birth control pills, weight, or travel when there might be more to the story.  If you haven't experienced a recent major risk factor there is a good chance that there is more to your clot's story.

Activity trackers can be amazingly useful in pulmonary embolism recovery.  Many of them are able to track the amount, time of, and frequency of activity throughout the day.  This tracking is automatic and easy.  When I was in recovery I was tracking some of this information by hand.  Now there are sleek little gadgets to do the work for you.

Activity trackers are small wearable devices that track the wearer's movements throughout the day.  They are similar to a pedometer but they are able to track more than just steps.  They are very easy to use.  Charge the battery, wear the tracker, and sync it with your phone or computer.

I have long been an advocate of tracking your recovery.  I found that logging data allowed me to see my own growth as a progressed through recovery.  I had my pulmonary embolism in 2008.  There were no activity trackers available.  I took walks that I timed, used a pedometer to count my steps, used a heart rate monitor watch, and measured my blood pressure.  Each of these measurements was hand tracked in a paper notebook.

The Fit Bit One is one of the many activity trackers on the market.  I bought one a few weeks ago after seeing family members with them at a family reunion.  My goal for my Fit Bit was simply to move more.  I have just started a work at home job and I know that it will be easy to gain weight.  As I have worn my Fit Bit One I have realized that it has a lot of potential in pulmonary embolism recovery and in the prevention of blood clots.  I am going to share some of the features of the Fit Bit One with you.  While I own a Fit Bit One, I know that other activity trackers have similar features.  I will share some of the other brands and the end of this article.

One of the best things about the Fit Bit One is that it is tiny and unobtrusive.  In my picture you can see my Fit Bit inside of its rubber clip case.  I wear it clipped to my bra.  You can't even tell that it is on when I wear it.  If you don't want it on your bra, or if you are a guy, you can wear it clipped on your pants waistband.  Fit Bit and other brands also offer models that can be worn as a bracelet.

Activity trackers often have the ability to track steps, calories burned, exercise activities, floors climbed, calories consumed, and sleep patterns.  Activity trackers also record time.  This lets you see when you were active and how active you were at times throughout the day.  (Check the specific models to see which of these features are available.)  Most activity trackers, like my Fit Bit One, sync with a smart phone and computer so that all of the tracking data can be stored, analyzed, and compared.  These features make activity trackers very useful for pulmonary embolism survivors.

Activity trackers are very useful in pulmonary embolism recovery because of their ability to automatically track and record data over time.  Many of the new trackers don't even need a cable to sync with your smart phone or computer; they just automatically connect over a wireless connection as you go about your day.  This means that all you have to do is make sure that you have your tracker on.  As long as it is on, you are good to go.

Pulmonary embolism survivors can wear an activity tracker during recovery to track improvements in activity level.  My Fit Bit One sends me an email once a week with updates on my stats.  It gives me a little arrow to show me if I have improved that statistic from the previous week.  I can also go through my days one at a time on the Fit Bit website and or flip through my data throughout the day on either my iPhone or Fit Bit One.  Data is a great way to get an unbiased snapshot of recovery.  The more stamina that you have, the more steps you will walk in a day.  These numbers should improve throughout recovery.  

You can also use this data to set recovery goals for yourself.  Fit  Bit and other trackers allow you to set personal activity goals.  I started my Fit Bit One journey at 2,000 steps a day.  It took a while to get that number every week.  I then upped it to 2,500 steps a day.  You can set goals for any of the things that Fit Bit measures (calories, floors climbed, active minutes, and etc.). 

Another use for an activity tracker is to monitor weight during recovery and to assist in weight loss.  Weight loss decreases the risk of future clots and is a common recommendation from the medical community.  Fit Bit is able to track the calories that I eat and the calories that I am expending.  I can set calorie goals based on my weight loss needs.

I got my Fit Bit One to help me to increase my activity levels and to assist in weight management.  As I have worn my Fit Bit One I have realized that it is helping me to monitor my movement throughout the day.  Weight loss and movement are two of the most effective pulmonary embolism preventatives.  My activity monitor is assisting with both of these preventatives.  I knew that my Fit Bit would help me to track calories.  What I didn't realize was how useful its data logging is in my own pulmonary embolism prevention quest.

If you look at my Fit Bit dashboard you will see the graph in the upper left hand corner.  This shows me the hours of the day on the bottom and then puts a line in whenever I walk throughout the day.  i can also look at the floors that I climb or the calories that I burn.  This lets me check myself to see if I am getting up enough throughout the day.  You can see that on this day I didn't walk much after 6 PM or before 10:00 AM.  The later steps were likely missing because I looked at my computer around 5 or 6 PM.  The morning appears to have been largely inactive.  This tells me that I need to review my activity throughout the day to ensure that I am moving.  Individuals with a history of pulmonary embolism should move at least once every two hours.  My Fit Bit keeps an eye on me and lets me know when I am not doing this well.

(Different activity monitors will handle their data in different ways.  Many are able to sync with a computer and a smartphone.  Make sure to check the models out though as some only store data on the unit.  I believe that the computer tracking that you see above is vital for a pulmonary embolism survivor.  I highly recommend that you pick out a tracker that is able to hook up with a smart phone and/or a computer.)

Throughout the day when I am not at my computer I use my iPhone to check on my progress.  I can look at my Fit Bit but it doesn't give me as much data and I wear it clipped to my bra so I can't see it in public.  The FitBit uses bluetooth to automatically update my iPhone as the day passes.  While you dot have to have a phone to use it, it comes with a USB dongle to sync with a computer, I love that I don't have to think about it when it is set up with my iPhone.

Each of these lines can be tapped.  When you tap the specific type of data, a chart comes up with a timeline.  Like the computer program you are able to see how that measurement varied throughout the day.  I find that simply watching steps to see when I have moved helps me to track myself.  I work at home and making sure that I am moving throughout the day is important.  This bit of feedback let's me know if I need to modify my habits.