<?xml version="1.0" encoding="UTF-8"?>
<rss version="2.0" xmlns:content="http://purl.org/rss/1.0/modules/content/" xmlns:wfw="http://wellformedweb.org/CommentAPI/" xmlns:dc="http://purl.org/dc/elements/1.1/" >

<channel><title><![CDATA[The Clot Spot - Articles]]></title><link><![CDATA[http://www.clotspot.com/articles]]></link><description><![CDATA[Articles]]></description><pubDate>Wed, 15 Oct 2025 00:39:39 -0400</pubDate><generator>Weebly</generator><item><title><![CDATA[The Hidden Dangers of Genetic Testing]]></title><link><![CDATA[http://www.clotspot.com/articles/the-hidden-dangers-of-genetic-testing]]></link><comments><![CDATA[http://www.clotspot.com/articles/the-hidden-dangers-of-genetic-testing#comments]]></comments><pubDate>Sun, 24 Jul 2016 01:00:00 GMT</pubDate><category><![CDATA[prevention]]></category><category><![CDATA[testing]]></category><category><![CDATA[thrombophilia]]></category><category><![CDATA[tips]]></category><category><![CDATA[treatments]]></category><guid isPermaLink="false">http://www.clotspot.com/articles/the-hidden-dangers-of-genetic-testing</guid><description><![CDATA[This picture is by Darryl Leja, NHGRI. It is in the public domain at http://www.genome.govShould you and your family be tested for genetic conditions that can cause blood clots?&nbsp; After you have had a pulmonary embolism or DVT (deep vein thrombosis) you may think that the answer is an easy, “YES!”&nbsp; It isn’t.&nbsp; Genetic testing comes at a price.&nbsp; You need to know what that price is and if you are willing to pay it.&nbsp; You also need to know if you are willing to make that [...] ]]></description><content:encoded><![CDATA[<span class='imgPusher' style='float:left;height:0px'></span><span style='display: table;width:auto;position:relative;float:left;max-width:100%;;clear:left;margin-top:0px;*margin-top:0px'><a><img src="http://www.clotspot.com/uploads/9/0/1/9/9019259/785708025.jpg" style="margin-top: 5px; margin-bottom: 10px; margin-left: 0px; margin-right: 10px; border-width:1px;padding:3px; max-width:100%" alt="Picture" class="galleryImageBorder wsite-image"></a><span style="display: table-caption; caption-side: bottom; font-size: 90%; margin-top: -10px; margin-bottom: 10px; text-align: center;" class="wsite-caption">This picture is by Darryl Leja, NHGRI. It is in the public domain at http://www.genome.gov</span></span><div class="paragraph" style="text-align:justify;display:block;">Should you and your family be tested for genetic conditions that can cause blood clots?&nbsp; After you have had a pulmonary embolism or DVT (deep vein thrombosis) you may think that the answer is an easy, &ldquo;YES!&rdquo;&nbsp; It isn&rsquo;t.&nbsp; Genetic testing comes at a price.&nbsp; You need to know what that price is and if you are willing to pay it.&nbsp; You also need to know if you are willing to make that decision for your children and other family members.&nbsp; Get ready for a quick ride through genetics, genetic testing, and the dark side of testing for genetic blood clotting conditions.<br><br>Blood clotting conditions raise the risk of forming blood clots in the lungs (pulmonary embolism) or in the large veins in your body (deep vein thrombosis).&nbsp; These clots can be very serious and often have a lengthy recovery period.&nbsp; Sometimes these clots are fatal.&nbsp;<br>We can break clotting conditions into two general groups: genetic and non-genetic.&nbsp; Genetic clotting conditions come from one of your parents by way of the genes that were carried in an egg or sperm cell when you were conceived.&nbsp; Non-genetic clotting conditions do not come from your parents.&nbsp; These can come from things like cancer, other diseases, or things that we haven&rsquo;t discovered yet.&nbsp; We are going to focus on the first group, clotting conditions that are caused by genetics.<br><br>When you were conceived you received genetic material from your mother and father.&nbsp; For instance, I have blue eyes.&nbsp; I have one gene for blue eyes from my mother and one gene for blue eyes from my father.&nbsp; I also have a clotting condition called Factor V Leiden.&nbsp; I have one good copy of the Factor V Leiden gene.&nbsp; It came from my mother.&nbsp; I also have one mutated gene from my father.&nbsp; (We will come back to this a little later.)<br><br>Your DNA looks a bit like a spring shaped ladder.&nbsp; It is made up of 4 chemicals that we typically refer to in an abbreviated form: A, G, T, and C.&nbsp; Each ladder rung has a pair of letter with one side from mom and the other side from dad.&nbsp; Each ladder rung is responsible for an instruction about who and what you are.&nbsp; Scientists have mapped out these ladder rungs.&nbsp; Each step is a location and each location has certain patterns of A, G, T, C that are acceptable.&nbsp; If just one of those letters is off, your genetic code has a &ldquo;mutation&rdquo;.&nbsp; Mutations may do something small like change your hair color.&nbsp; Unfortunately, mutations can also do something more serious like impacting how your blood clots.&nbsp; These blood clotting mutations are what doctors are looking for when they run tests for genetic blood clotting conditions.<br><br>Genetic testing takes some material from your body, pulls out the DNA, and then looks at certain sections of that DNA to see if it has the correct chemicals in the correct places. For example, one wrong letter in this section of DNA causes Factor V Leiden: GCAAGAACTGCAGGGGAGGAGGACGCTGCCACCCACAGCCTCTAGAGCTCATTGCAGCTGGGACAGCCCGGAGTGTGGTTATGTTTGGGCTATTATCTAATGCTGTGTAGAAATATTAAAACCCCTGTTATTTTGAAATAAAAAAGATACCCACTTTT.&nbsp; A DNA test scans for mistakes and uses them to identify any clotting conditions.<br><br>DNA testing has a number of benefits.&nbsp; First, these tests are very accurate because your DNA never changes.&nbsp; You get your DNA at conception and you have the same DNA throughout every cell in your body your entire life.&nbsp; Blood clots and anticoagulation will not change your DNA. Second, DNA tests may also help other family members understand any increased blood clots risks.&nbsp; As DNA is passed through parents to offspring you can figure out who should watch carefully for clots without having them tested.&nbsp; Lastly, DNA testing can be done before something goes wrong.&nbsp; Your doctor can test you and warn you of potential health issues before they happen.&nbsp; This gives you a chance to avoid problems that faulty DNA may cause.<br><br>So, if DNA testing is so useful, why am I writing an article about the dark side of genetic testing?&nbsp; Knowing your DNA comes at a cost.&nbsp; You may learn that you or your family member has an incurable condition.&nbsp; You may pay for a test that doesn&rsquo;t matter because the disease never would have showed up in that person. (Factor V Leiden only has a 1 in 10 chance of causing a clot!).&nbsp; DNA testing may cause unneeded fear and stress.&nbsp; Low risk clotting conditions typically are not medicated as the medication is higher risk than the chance of serious illness from a clot.&nbsp; Someone may end up taking unneeded medication and have serious side effects.&nbsp; Medical treatment after genetic testing isn&rsquo;t always clear.<br><br>Health isn&rsquo;t the only risk with DNA testing.&nbsp; There is another very large and very real risk with genetic testing, discrimination.&nbsp; In 2008 the Genetic Discrimination Nondiscrimination Act (GINA) was enacted to protect Americans from job and medical insurance discrimination from results of genetic testing.&nbsp; GINA ensures that health insurance companies cannot ask you about any DNA testing or any DNA test results when you apply for insurance.&nbsp; GINA also states that employers may not ask for the results of DNA testing when making hiring or promotion decisions.&nbsp; GINA is a good start but there are still many places that can discriminate based on genetic test results.<br><br>Genetic discrimination can still be found in many places.&nbsp; Life insurance, annuities, banks, home insurance, travel insurance, and disability insurance can all review the results of past DNA testing before determining eligibility.&nbsp; It doesn&rsquo;t matter when the testing occurred.&nbsp; A parent may have a 6-year-old child tested for genetic clotting conditions.&nbsp; When the child is 46 that genetic information may still disqualify him or her from participating in certain services.&nbsp; Your DNA never changes so the results of a DNA test will follow you forever, even if you were not the person that decided to have the test done.&nbsp; Another place discrimination shows up is in subconscious discrimination.&nbsp; A possible date might turn a woman down to blood clot risks in pregnancy.&nbsp; You may be passed over for a job after your workplace hears about your results because your boss is subconsciously concerned that stress may cause clots.&nbsp; Some of these forms of discrimination are obvious, some are not.&nbsp; They all share one thing in common: they are a result of a DNA test.<br>DNA testing is often used when blood clots occur.&nbsp; DNA testing can help you to determine your treatment.&nbsp; It can also help family members avoid future clots.&nbsp; The problem is that genetic testing, like all medical procedures, should be weighed carefully.&nbsp; Some people want to have all of their children and close family members tested.&nbsp; I recommend talking to different doctors before jumping into family blood testing.&nbsp; If the blood testing will have a significant impact in medical treatment it may be warranted.&nbsp; On the other hand, if the DNA test is being used as nothing more than a precaution, you may decide that your own clotting history is enough precaution on its own.&nbsp; Ask your doctor how treatment will change based on the DNA test results.&nbsp; The social and monetary costs must be determined and considered.<br><br>Back to my story...<br>After my clots in 2008 we decided not to have my parents tested.&nbsp; As a family we did inform other family members of my medical history and Factor V Leiden diagnosis so that they could be on the lookout for clots and could enact clot prevention strategies.&nbsp; Since then both of my parents had surgery.&nbsp; While the doctor didn&rsquo;t require it, they chose to have Factor V Leiden testing.&nbsp; My dad was my gene donor.&nbsp; It didn&rsquo;t change their surgeries much.&nbsp; My mom who does not have Factor V Leiden was given pressure cuffs and anticoagulation as she had a high risk surgery.&nbsp; My dad&rsquo;s surgery was much less serious and had the pressure cuffs while in surgery.&nbsp; Thankfully, neither clotted.<br><br>For more information about genetic testing I highly recommend an episode of Neil DeGrasse Tyson&rsquo;s podcast called Star Talk.&nbsp; Season 7, episode 9 is titled <em>The Promise and Peril of the Genomic Revolution.&nbsp;</em> It features one of the founders of 23 and Me and discusses the morality and future of genetic testing.&nbsp; This episode can be found here: <a href="https://soundcloud.com/startalk/the-promise-and-peril-of-the-genomic-revolution">https://soundcloud.com/startalk/the-promise-and-peril-of-the-genomic-revolution</a>&nbsp;or you can listen to it below.<br><br></div><hr style="width:100%;clear:both;visibility:hidden;"><div><div id="123253317657648789" align="center" style="width: 100%; overflow-y: hidden;" class="wcustomhtml"><iframe width="100%" height="166" scrolling="no" frameborder="no" src="https://w.soundcloud.com/player/?url=https%3A//api.soundcloud.com/tracks/261515030&amp;color=ffcc00&amp;show_artwork=false"></iframe></div></div>]]></content:encoded></item><item><title><![CDATA[FAQ: Is It Normal To Have Symptoms After The Clots Are Gone?]]></title><link><![CDATA[http://www.clotspot.com/articles/faq-is-it-normal-to-have-symptoms-after-the-clots-are-gone]]></link><comments><![CDATA[http://www.clotspot.com/articles/faq-is-it-normal-to-have-symptoms-after-the-clots-are-gone#comments]]></comments><pubDate>Tue, 05 Jul 2016 01:07:20 GMT</pubDate><category><![CDATA[deep vein thrombosis (DVT)]]></category><category><![CDATA[faq]]></category><category><![CDATA[pulmonary embolism]]></category><category><![CDATA[recovery]]></category><guid isPermaLink="false">http://www.clotspot.com/articles/faq-is-it-normal-to-have-symptoms-after-the-clots-are-gone</guid><description><![CDATA[The time that it takes pulmonary embolisms to go away and the time that it takes to heal from a pulmonary embolism are different.&nbsp; Blood clots in your lungs and DVTs cause damage.&nbsp; The damage is what causes symptoms.&nbsp; Blood clots in your lungs can cause heart damage, lung damage, and psychological damage.&nbsp; A deep vein thrombosis can cause vein damage and valve damage.&nbsp; Both of these conditions may cause your to become less active.&nbsp; Lowered activity causes deconditio [...] ]]></description><content:encoded><![CDATA[<div class="paragraph" style="text-align:left;">The time that it takes pulmonary embolisms to go away and the time that it takes to heal from a pulmonary embolism are different.&nbsp; Blood clots in your lungs and DVTs cause damage.&nbsp; The damage is what causes symptoms.&nbsp; Blood clots in your lungs can cause heart damage, lung damage, and psychological damage.&nbsp; A deep vein thrombosis can cause vein damage and valve damage.&nbsp; Both of these conditions may cause your to become less active.&nbsp; Lowered activity causes deconditioning and fatigue.<br /><br />Symptoms of your blood clots will last longer than the clot itself.&nbsp; Bodies often dissolve clots pretty quickly.&nbsp; After the clot is gone your body goes to work healing the damage.&nbsp; Healing can take a long time and may include fatigue, pain, and clot symptoms.&nbsp; Talk to your doctor about your healing and your symptoms as it is possible that he or she can help you have a less irritating recovery.<br /><br />While your blood clots are gone, the damage is not gone.&nbsp; Be patient and keep your doctor informed about your recovery.&nbsp; Gradually increase activity as you are able.&nbsp; Most survivors find the symptoms have greatly improved 1-2 years post diagnosis.&nbsp; Remember that your body is healing from major trauma.&nbsp; Think about how tired a cold can make you for weeks after the cold is gone.&nbsp; Now remember that a cold causes much less damage to your body.<br /></div>]]></content:encoded></item><item><title><![CDATA[Finding The Best Treatment: Avoiding Common Misconceptions]]></title><link><![CDATA[http://www.clotspot.com/articles/-finding-the-best-treatment-avoiding-common-misconceptions]]></link><comments><![CDATA[http://www.clotspot.com/articles/-finding-the-best-treatment-avoiding-common-misconceptions#comments]]></comments><pubDate>Sat, 22 Aug 2015 20:12:16 GMT</pubDate><category><![CDATA[tips]]></category><category><![CDATA[treatments]]></category><guid isPermaLink="false">http://www.clotspot.com/articles/-finding-the-best-treatment-avoiding-common-misconceptions</guid><description><![CDATA[  Did you know that your brain is trying to prevent you from receiving the best medical care for your blood clot or clotting condition?&nbsp; Your brain is faced with an uncountable amount of information every day.&nbsp; In order to process all of this information the human brain has developed rules and ways of thinking to allow it to quickly sort, process, and act on massive amounts of data.&nbsp; While our brains do a miraculous job handling this data they also can lead us to false conclusions [...] ]]></description><content:encoded><![CDATA[<div class="paragraph" style="text-align:left;">  Did you know that your brain is trying to prevent you from receiving the best medical care for your blood clot or clotting condition?<span style="">&nbsp; </span>Your brain is faced with an uncountable amount of information every day.<span style="">&nbsp; </span>In order to process all of this information the human brain has developed rules and ways of thinking to allow it to quickly sort, process, and act on massive amounts of data.<span style="">&nbsp; </span>While our brains do a miraculous job handling this data they also can lead us to false conclusions that can slow our healing and put us at a greater risk for significant health problems in the future.<span style="">&nbsp; </span>In today&rsquo;s article we are going to review how the brain processes information and look at some of the most common errors in thinking that may negatively affect your medical care.<br /><span style=""></span><br /><span style=""></span>  Humans make mistakes in thinking due to how the brain handles information.<span style="">&nbsp; </span>The name for these errors is cognitive bias.<span style="">&nbsp; </span>Research has shown that learning about cognitive biases can help you make better decisions.<span style="">&nbsp; </span>Better decisions will lead to better healthcare, faster healing, and a lowered risk of future clots.<br /><span style=""></span><br /><span style=""></span>  <strong>Recency effect</strong><br /><span style=""></span>Have you found yourself looking back into the days and weeks before your clot to try to figure out what caused it?<span style="">&nbsp; </span>Be careful, you may find your brain suffering from the recency effect.<span style="">&nbsp; </span>Our brains tend to look at how close together two things happened in time.<span style="">&nbsp; </span>The more recently something happened the more likely we are to think that it was the cause.<span style="">&nbsp; </span>Maybe you ran a marathon, started a new medication, or took a supplement in the days leading up to your blood clot.<span style="">&nbsp; </span>While these might be the cause of your clot it is also possible that genetics, pregnancy, or other long term risk factors were the cause of your clot.<span style="">&nbsp; </span>It is also possible that your clot was caused by multiple risk factors rather than a solitary event.<span style="">&nbsp; </span>It is important for you and your medical tem to evaluate all of your risks rather than the ones that may have just happened.<br /><span style=""></span><br /><span style=""></span>  <strong>Confirmation bias</strong><br /><span style=""></span>Did you jump on the Internet to see what caused your clot?<span style="">&nbsp; </span>Be careful, we tend to favor information that supports what we already believe.<span style="">&nbsp; </span>Humans have a difficult time believing evidence that tells them what they think is wrong.<span style="">&nbsp; </span>Let&rsquo;s look at an example.<span style="">&nbsp; </span>Sally has a blood clot and her doctor puts her on warfarin, an anticoagulant.<span style="">&nbsp; </span>Sally knows that warfarin is also used as rat poison so she is very uncomfortable with this medication.<span style="">&nbsp; </span>She goes to the Internet to read about warfarin.<span style="">&nbsp; </span>She reads five articles that state that warfarin is safe and one article that states warfarin is dangerous.<span style="">&nbsp; </span>Sally favors the one article that states that warfarin is dangerous because it supports what she already believed.<span style="">&nbsp; </span>She goes to her doctor and asks to switch medications.<span style="">&nbsp; </span>The human brain doesn&rsquo;t like to be wrong.<span style="">&nbsp; </span>When doing research it is a good idea to try to prove yourself wrong rather than right.<br /><span style=""></span><br /><span style=""></span>  <strong>Faulty generalization</strong><br /><span style=""></span>Looking at other people&rsquo;s experiences can be comforting but it can also cause errors in thinking.<span style="">&nbsp; </span>Human brains tend to over estimate how many times something happens.<span style="">&nbsp; </span>We often think that if we meet one person that had something happen this must be true for everyone.<span style="">&nbsp; </span>Here are some examples.<span style="">&nbsp; </span><br /><span style=""></span><br /><span style=""></span>  Sam&rsquo;s mother died of a brain bleed while taking a newer anticoagulant.<span style="">&nbsp; </span>Bob&rsquo;s mother takes warfarin and has no side effects.<span style="">&nbsp; </span>This must mean that warfarin is safer.<span style="">&nbsp; In reality some of the newer anticoagulants have a much lower risk of brain bleeds.&nbsp; </span>In this example I don&rsquo;t pay attention to the fact that I need to look at thousands if not millions of examples to know which medication is safer.<span style="">&nbsp; </span>One example does not tell me how other people overall react to a medication.<span style="">&nbsp; </span>This is why we need thousands of people in drug studies.<br /><span style=""></span><br /><span style=""></span>  Mary had a blood clot while on birth control.<span style="">&nbsp; </span>It must be very dangerous.<span style="">&nbsp; </span>Again I am looking at just one person.<span style="">&nbsp; </span>I did not consider the millions of people who didn&rsquo;t have a clot on birth control.<span style="">&nbsp; </span>Pregnancy is a larger risk factor than birth control.<span style="">&nbsp; </span>I missed that information though because I only focused on my friend Mary.<br /><span style=""></span><br /><span style=""></span>  To overcome this error in thinking make sure to read studies that look at thousands of people.<span style="">&nbsp; </span>Ask your doctor for advice about medications.<span style="">&nbsp; </span>Doctors are trained to read medical papers and understand risk factors.<span style="">&nbsp; </span>It is a good idea to ask your doctor why he or she favors a treatment or preventative measure.<span style="">&nbsp; </span>Feel free to ask for the research so that you can be confident that your healthcare decision is based on the full picture rather than just one or two people.<span style="">&nbsp; </span>Be careful on support groups.<span style="">&nbsp; </span>They are a great resource but make sure that you aren&rsquo;t taking a few people&rsquo;s experiences and favoring them over well researched information.&nbsp; Just because it happened to one person doesn't mean that it will happen to you.<br /><span style=""></span><br /><span style=""></span>  <strong>Negativity bias</strong><br /><span style=""></span>We tend to pay more attention to bad news versus good news.<span style="">&nbsp; </span>When we see a lawyer add on television for malpractice we believe that this is happening everywhere and we can&rsquo;t trust the medical community.<span style="">&nbsp; </span>We hear about blood clots or bleeds being associated with treatments and we don&rsquo;t see the millions of people who benefit from these treatments.<span style="">&nbsp; </span>We hear about people who struggle to recovery from a pulmonary embolism and don&rsquo;t see those who heal in two weeks.<span style="">&nbsp; </span>We see our own misery and don&rsquo;t see that we can ever heal.<span style="">&nbsp; </span>I recommend that you try to intentionally focus on the positives.<span style="">&nbsp; </span>Keep a list of five good things that happen a day.<span style="">&nbsp; </span>Chart your progress that you make in recovery on a daily or weekly basis.<span style="">&nbsp; </span>Pay attention to those people in support groups who are thriving.<span style="">&nbsp; </span>These will lighten your heart and help you to avoid the negativity bias.<br /><span style=""></span><br /><span style=""></span>  <strong>Wrong authority</strong><br /><span style=""></span>We don&rsquo;t do a good job knowing who to trust. <span style="">&nbsp;</span>We may find advertisements and peers better sources of information than our doctors.<span style="">&nbsp; </span>Make sure that you use your medical team as your main source of information.<span style="">&nbsp; </span>It can be difficult to know which articles online can be trusted.<span style="">&nbsp; </span>If you want to read more on a topic you can visit a library and ask the librarian for help in finding information from reliable sources.<span style="">&nbsp; </span>If you happen to have a medical school near you then take advantage of it!<span style="">&nbsp; </span>It will have a medical library with a trained medical librarian.<br /><span style=""></span><br /><span style=""></span>  If you struggle with trusting your doctor try these ideas:<br /><span style=""></span><br /><ol><li>  <span style=""><span style=""></span></span>Ask questions until you know why your doctor feels a certain diagnosis or treatment is correct</li><li>  <span style=""><span style=""></span></span>Ask why NOT the alternate diagnosis or treatment</li><li>  <span style=""><span style=""></span></span>Seek second opinions from other doctors</li><li>  <span style=""><span style=""></span></span>Ask your pharmacist</li><li><span style=""><span style=""><span style=""></span></span></span>Find a support group or questions and answer service that is staffed by doctors</li><li>  <span style=""><span style=""><span style=""></span></span></span>Ask different types of doctors and have a variety of doctors on your team (OBGYN, GP, internist, hematologist, radiologist, pulmonologist)</li><li>  <span style=""><span style=""><span style=""></span></span></span>Consult sites that are written for doctors by professional organizations</li><li>  <span style=""><span style=""><span style=""></span></span></span>Use sites that end in .gov or .edu for your research</li><li>Get a doctor that you trust</li></ol><br /><br /><span></span><br /><span></span><span style=""></span>  <strong>How to overcome biases in thought</strong><br /><span style=""></span><br /><ol><li>  <span style=""><span style=""><span style=""></span></span></span>Look for research that disproves your belief and seriously consider it.</li><li>Don&rsquo;t take one person&rsquo;s story and use it as the basis for your treatment.<span style="">&nbsp; </span>Use professional research and the opinion of your medical treatment team as the basis of your treatment decisions.</li><li>  <span style=""><span style=""><span style=""></span></span></span>Make sure to take note of the positives as well as the negatives.</li><li>  <span style=""><span style=""><span style=""></span></span></span>Don&rsquo;t panic when you hear lawyer ads.<span style="">&nbsp; </span>You can use them as a sign you should research something more.<span style="">&nbsp; </span>Do not assume that because there is a malpractice ad that there really is a huge problem with a treatment.</li><li>  <span style=""><span style=""><span style=""></span></span></span>Look at research statistics not individual experiences.</li><li>  <span style=""><span style=""><span style=""></span></span></span>Use reliable sources.<span style="">&nbsp; </span>Many end in .edu or .gov.<span style="">&nbsp; </span>A librarian can also point you towards reliable places to get information.</li><li>  <span style=""><span style=""><span style=""></span></span></span>Find professional organizations that deal in clots.<span style="">&nbsp; </span>The Clot Spot has a great list of these in the resources section.</li><li>  <span style=""><span style=""><span style=""></span></span></span>Don&rsquo;t panic!</li></ol><span style=""></span><br /><span style=""></span>    </div>]]></content:encoded></item><item><title><![CDATA[Choosing Your Anticoagulant]]></title><link><![CDATA[http://www.clotspot.com/articles/choosing-your-anticoagulant]]></link><comments><![CDATA[http://www.clotspot.com/articles/choosing-your-anticoagulant#comments]]></comments><pubDate>Sun, 16 Aug 2015 09:35:05 GMT</pubDate><category><![CDATA[anticoagulant]]></category><category><![CDATA[blood thinner]]></category><category><![CDATA[coumadin]]></category><category><![CDATA[lovenox]]></category><category><![CDATA[warfarin]]></category><category><![CDATA[warfarin alternatives]]></category><category><![CDATA[Xarelto]]></category><guid isPermaLink="false">http://www.clotspot.com/articles/choosing-your-anticoagulant</guid><description><![CDATA[Prescription pill bottle by francesco_rollandin at openclipart.org After a clot you have a number of anticoagulants available for treatment.&nbsp; Currently, there are three anticoagulants that are approved for the treatment of pulmonary embolism and deep vein thrombosis.&nbsp; These three medications are Lovenox (enxaparin), Coumadin (warfarin), and Xarelto (rivaroxaban).&nbsp; This article will review what I know about each medication.&nbsp; Remember to discuss all of your options with your do [...] ]]></description><content:encoded><![CDATA[<span class='imgPusher' style='float:left;height:0px'></span><span style='display: table;z-index:10;width:auto;position:relative;float:left;max-width:100%;;clear:left;margin-top:0px;*margin-top:0px'><a><img src="http://www.clotspot.com/uploads/9/0/1/9/9019259/253703638.png?250" style="margin-top: 10px; margin-bottom: 10px; margin-left: 0px; margin-right: 10px; border-width:0; max-width:100%" alt="Picture" class="galleryImageBorder wsite-image" /></a><span style="display: table-caption; caption-side: bottom; font-size: 90%; margin-top: -10px; margin-bottom: 10px; text-align: center;" class="wsite-caption">Prescription pill bottle by francesco_rollandin at openclipart.org</span></span> <div class="paragraph" style="text-align:left;display:block;">After a clot you have a number of anticoagulants available for treatment.&nbsp; Currently, there are three anticoagulants that are approved for the treatment of pulmonary embolism and deep vein thrombosis.&nbsp; These three medications are Lovenox (enxaparin), Coumadin (warfarin), and Xarelto (rivaroxaban).&nbsp; This article will review what I know about each medication.&nbsp; Remember to discuss all of your options with your doctor.<br /><br /><strong>Medication Descriptions:</strong><br />Coumadin is the oldest medication on the list.&nbsp; It blocks vitamin K.&nbsp; Each person needs a different amount of Coumadin to achieve a safe range of medication.&nbsp; This amount of medication changes daily based on diet and other medications.&nbsp; Patients must eat a consistent amount of vitamin K daily in order to have the right amount of Coumadin.&nbsp; This medication is very picky.&nbsp; Too small of a dose raises the risk of clots and too high a dose raises the risk of a bleed.&nbsp; Because the dosing must be very precise in order to be safe and effective, people who take Coumadin must have routine blood tests.&nbsp; These tests may be done at home by working with a doctor to purchase a home testing machine or they can be done at a doctors office.<br /><br />Lovenox is an injection that can be given at home by the patient.&nbsp; It is self-injected into the fat around the abdomen.&nbsp; Typically patients will do injections twice a day.&nbsp; Lovenox doses are much more consistent from patient to patient.&nbsp; For this reasons you will not need routine blood work done while you are on Lovenox.&nbsp; Lovenox is much more expensive than Coumadin, but you will not have to pay for weekly blood testing.&nbsp; Lovenox has no dietary restrictions.&nbsp; You can eat a massive salad one day and no vitamin K containing foods the next day without having to worry about your medication levels.<br /><br />Xarelto is the newest of the approved medications.&nbsp; It is an oral medication.&nbsp; It has no dietary restrictions.&nbsp; It also is very consistent from patient to patient so it doesn't require routine blood work.&nbsp; As it is new, there are no generic versions of this medication.&nbsp; Payment assistance can be found on the <a target="_blank" href="https://www.xarelto-us.com/carepath/savings-program">manufacturer's website.</a>&nbsp; Like Lovenox, Xarelto has no dietary restrictions.<br /><br /><strong>Effectiveness of the Different Anticoagulants:<br /></strong>Studies have shown that all three medications are about equally matched in effectiveness when they are used as directed.&nbsp; As directed is very important to note.&nbsp; If you are prone to missing doses, the newer anticoagulants aren't for you.&nbsp; The new anticoagulants must be taken more frequently and they leave your body quickly.&nbsp;<a target="_blank" href="http://asheducationbook.hematologylibrary.org/content/2012/1/536.full"> Missing a dose of medications like Xarelto will put you at a high risk of clotting.</a> Coumadin has similar problems.&nbsp; If you can't maintain a high enough level of Coumadin, you risk a clot.&nbsp; If you don't feel that you can track your vitamin K intake or if your INR test results are showing a lot of fluctuations, you may want to ask your doctor about switching to a different medication.<br /><br /><strong>Bleeding Risk:<br /></strong>Coumadin can have a high risk of major bleeds if the blood levels are not kept within range.&nbsp; This risk goes up with age and with certain health conditions.&nbsp; Out of the anticoagulants, Coumadin has the highest risk of cranial (head) bleeds.&nbsp; Coumadin takes 5-7 days to leave your system completely.&nbsp; If you start to bleed or need surgery an antidote will be needed.&nbsp; This can cause problems.&nbsp; Luckily, years of use have established many FDA approved means of reversing Coumadin's anticoagulant effect.<br /><br />Lovenox has a similar risk of bleeds.&nbsp; It also takes a number of days to leave the body.&nbsp; For this reason it should not be used before surgery.&nbsp; Lovenox also has a number of FDA approved antidotes to reverse bleeding.&nbsp; Diet and dosing will not impact the bleeding risk.&nbsp; The biggest risk of bleeding on Lovenox is caused by heparin-induced                thrombocytopenia.&nbsp; If you have ever had heparin-induced                thrombocytopenia let your doctor know immediately.<br /><br />Xarelto has a much lower risk of cranial (head) bleeds than the other two options.&nbsp; It does carry a higher risk of stomach and intestine bleeds.&nbsp; Other bleeding risks are the same whether you take Coumadin, Lovenox, or Xarelto.&nbsp; Xarelto leaves your body quickly.&nbsp; This can help in a bleeding situation.&nbsp; Currently there are no FDA approved methods of reversing Xarelto.&nbsp; There are some unapproved methods that can be used to reverse bleeding.&nbsp; The FDA is reviewing some possible methods of reversal so there may be an antidote in the near future.&nbsp; If you are having problems keeping your INR in range, Xarelto may put you at a lower risk of a major bleed.<br /><br /><strong>Other Side Effects:<br /></strong>Everyone's body is different.&nbsp; You may find that your have side effects other than a bleed.&nbsp; If you are having something happen that is uncomfortable or unfamiliar I highly recommend talking to your pharmacist and medical team.&nbsp; Switching medications may make you feel a lot better while keeping you safe.&nbsp; If you switch and the symptom hasn't gone away, talk to your doctor as you may have another health problem that needs to be addressed.<br /><strong><br />Other Things to Continue:</strong><br />If you have other health issues let your doctor know.&nbsp; Pregnancy, cancer, kidney or liver problems, and other health issues can change which medication is recommended for your situation.<br /><br />Anticoagulants are a life saving class of medications that can help you to survive blood clots.&nbsp; When used correctly they are very safe.&nbsp; Very few people will have a life threatening bleed.&nbsp; For most people the risks of a clot far outweigh the risks of a bleed.&nbsp; While you will hear law firms advertising law suits against the newer anticoagulants, they are proving to be very safe and effective medications.&nbsp; Your doctor can review your options with you.&nbsp; Ask lots of questions and feel free to ask multiple pharmacists or doctors.&nbsp; These professionals are the best source of information about medications.<br /></div> <hr style="width:100%;clear:both;visibility:hidden;"></hr>]]></content:encoded></item><item><title><![CDATA[FAQ: When Should I Be Tested For Clotting Conditions?]]></title><link><![CDATA[http://www.clotspot.com/articles/faq-when-should-i-be-tested-for-clotting-conditions]]></link><comments><![CDATA[http://www.clotspot.com/articles/faq-when-should-i-be-tested-for-clotting-conditions#comments]]></comments><pubDate>Sat, 08 Aug 2015 09:15:37 GMT</pubDate><category><![CDATA[blood clot risks]]></category><category><![CDATA[faq]]></category><category><![CDATA[prevention]]></category><category><![CDATA[thrombophilia]]></category><guid isPermaLink="false">http://www.clotspot.com/articles/faq-when-should-i-be-tested-for-clotting-conditions</guid><description><![CDATA[  After a blood clot, tests can be run to determine if you have a condition that makes your blood clot more easily than the majority of the population.&nbsp; These conditions are often referred to as clotting conditions, thrombophilia, or hypercoagulable states.&nbsp; Testing for these conditions will not be able to predict who will and will not have a clot.&nbsp; About half of the people who have a clot will have no known cause.&nbsp; This means that the blood work would show no clotting condit [...] ]]></description><content:encoded><![CDATA[<div class="paragraph" style="text-align:left;"></div>  <div class="paragraph" style="text-align:left;">After a blood clot, tests can be run to determine if you have a condition that makes your blood clot more easily than the majority of the population.&nbsp; These conditions are often referred to as clotting conditions, thrombophilia, or hypercoagulable states.&nbsp; Testing for these conditions will not be able to predict who will and will not have a clot.&nbsp; About half of the people who have a clot will have no known cause.&nbsp; This means that the blood work would show no clotting conditions.<br /><br />Testing for thrombophilia is useful when deciding the length of time a patient will be on anticoagulants.&nbsp; The problem with anticoagulants is that they are risky.&nbsp; You only want to be on anticoagulants if the risk of clotting is larger than the risk of a life threatening bleed.&nbsp; Testing for thrombophilia will give you more information so that you and your doctor can determine which risk is more acceptable for you.<br /><br />To determine if thrombophilia testing is right for you, you should:<br /><ul style=""><li style="">Ask your doctor if having thrombophilia would change his or her recommendations about the amount of time that you will take anticoagulant medications.&nbsp; If the test will not change treatment, the test is not needed.</li><li style="">Talk with your doctor and insurance agents about the impact the findings may have on your ability to obtain life insurance.</li><li style="">Consider your age.&nbsp; Many recommendations state that individuals under the age of 50 that had a DVT or PE without a significantly large risk factor (abdominal surgery, bed ridden, cancer, or other major risks) have tests run to see what may have caused the clot.</li><li style="">Consider your risks.&nbsp; Can you and your doctor identify any MAJOR risks?&nbsp; A major risk may be able to be eliminated so that the clot doesn't repeat.&nbsp; If you only had a minor risk (weight and birth control are examples) there is a good chance that something else contributed to your clot.</li><li style="">Ask your medical team what they feel are typical, minor, and major risks for blood clots and figure out where you fit into that list.</li><li style="">Consider what risks will be in your future.&nbsp; Are you thinking about birth control, infertility treatments, cancer, hormone replacement, frequent long haul airplane trips, or any other big risks?&nbsp; You may want to know if you have a clotting condition that will put you at further risk.</li><li style="">Is there a family history of clotting or miscarriage?&nbsp; If there is, let your doctors know!<br /></li></ul> </div>  <div class="paragraph" style="text-align:left;">Think about your history, the costs, risks, and benefits.&nbsp; Medical testing seems harmless but it can have unwanted effects.&nbsp; If you need help deciding about testing please talk to your primary care provider and consider requesting a hematology consult.&nbsp; Feel free to get a second opinion.&nbsp; Many times doctors will write off a clot as a simple case of birth control&nbsp;pills, weight, or travel when there might be more to the story.&nbsp; If you haven't experienced a recent major risk factor there is a good chance that there is more to your clot's story.</div>]]></content:encoded></item><item><title><![CDATA[The Forums Are Fixed!]]></title><link><![CDATA[http://www.clotspot.com/articles/the-forums-are-fixed]]></link><comments><![CDATA[http://www.clotspot.com/articles/the-forums-are-fixed#comments]]></comments><pubDate>Fri, 24 Jul 2015 03:02:52 GMT</pubDate><category><![CDATA[website news]]></category><category><![CDATA[website updates]]></category><guid isPermaLink="false">http://www.clotspot.com/articles/the-forums-are-fixed</guid><description><![CDATA[Talk Bubbles by algotruneman openclipart.com The Clot Spot forums are back up and running.&nbsp; All they need is you!&nbsp; Nabble deleted our old forums so we have switched to a new service, ProBoards.&nbsp; The change has some great new features.&nbsp; The boards have more features, are easier to use, and work with the mobile app TapaTalk.&nbsp; The only downside is that right now the new forums are blank.&nbsp; I need your help to get them running again.&nbsp; Please click on the forums tab  [...] ]]></description><content:encoded><![CDATA[<span class='imgPusher' style='float:left;height:0px'></span><span style='display: table;z-index:10;width:216px;position:relative;float:left;max-width:100%;;clear:left;margin-top:0px;*margin-top:0px'><a><img src="http://www.clotspot.com/uploads/9/0/1/9/9019259/724142794.png?206" style="margin-top: 10px; margin-bottom: 10px; margin-left: 0px; margin-right: 10px; border-width:0; max-width:100%" alt="Picture" class="galleryImageBorder wsite-image" /></a><span style="display: table-caption; caption-side: bottom; font-size: 90%; margin-top: -10px; margin-bottom: 10px; text-align: center;" class="wsite-caption">Talk Bubbles by algotruneman openclipart.com</span></span> <div class="paragraph" style="text-align:left;display:block;">The Clot Spot forums are back up and running.&nbsp; All they need is you!&nbsp; Nabble deleted our old forums so we have switched to a new service, ProBoards.&nbsp; The change has some great new features.&nbsp; The boards have more features, are easier to use, and work with the mobile app TapaTalk.&nbsp; The only downside is that right now the new forums are blank.&nbsp; I need your help to get them running again.&nbsp; Please click on the forums tab and see how it goes.&nbsp; <br /><br />Please let me know if you have any problems with the new boards.&nbsp;I look forward to seeing an active Clot Spot community again!<br /><br /><br /><a href="http://clotspot.proboards.com" target="_blank">Check out the new forums by clicking HERE!</a></div> <hr style="width:100%;clear:both;visibility:hidden;"></hr>]]></content:encoded></item><item><title><![CDATA[Clotting, Genetics, Surgery, and Testing]]></title><link><![CDATA[http://www.clotspot.com/articles/clotting-genetics-surgery-and-testing]]></link><comments><![CDATA[http://www.clotspot.com/articles/clotting-genetics-surgery-and-testing#comments]]></comments><pubDate>Mon, 01 Jun 2015 20:30:02 GMT</pubDate><category><![CDATA[prevention]]></category><category><![CDATA[thrombophilia]]></category><guid isPermaLink="false">http://www.clotspot.com/articles/clotting-genetics-surgery-and-testing</guid><description><![CDATA[ After having a pulmonary embolism or DVT survivors begin to wonder about testing for blood clotting conditions and thrombophilia.&nbsp; There are genetic tests and blood chemistry tests that can be done to evaluate the survivor's risk of clotting.&nbsp; If a genetic test comes back positive it is now time to decide if family members should also be screened for clotting conditions.In my case I had some testing done immediately after I was diagnosed with pulmonary embolisms while I was still in t [...] ]]></description><content:encoded><![CDATA[<span class='imgPusher' style='float:left;height:0px'></span><span style='display: table;z-index:10;width:auto;position:relative;float:left;max-width:100%;;clear:left;margin-top:0px;*margin-top:0px'><a><img src="http://www.clotspot.com/uploads/9/0/1/9/9019259/3840744_orig.png" style="margin-top: 5px; margin-bottom: 10px; margin-left: 0px; margin-right: 10px; none; max-width:100%" alt="Picture" class="galleryImageBorder wsite-image" /></a><span style="display: table-caption; caption-side: bottom; font-size: 90%; margin-top: -10px; margin-bottom: 10px; text-align: center;" class="wsite-caption"></span></span> <div class="paragraph" style="text-align:justify;display:block;"><span style='text-decoration:none; font-style:normal; font-weight:400; color:rgb(51, 0, 0); '><span style="color: rgb(51, 0, 0); font-style: normal; font-weight: 400; text-decoration: none;"><span style="color: rgb(51, 0, 0); font-style: normal; font-weight: 400; text-decoration: none;"><span style="color: rgb(51, 0, 0); font-style: normal; font-weight: 400; text-decoration: none;">After having a pulmonary embolism or DVT survivors begin to wonder about testing for blood clotting conditions and thrombophilia.&nbsp; There are genetic tests and blood chemistry tests that can be done to evaluate the survivor's risk of clotting.&nbsp; If a genetic test comes back positive it is now time to decide if family members should also be screened for clotting conditions.<br /><br />In my case I had some testing done immediately after I was diagnosed with pulmonary embolisms while I was still in the hospital.&nbsp; While the blood chemistry tests are useless while on warfarin and heparin the genetic tests came back with useful information.&nbsp; My hematologist found out that I have heterozygous Factor V Leiden.<br /><br />Factor V Leiden is a mutation of one of the pieces of genetic information that tells the blood how to turn off clotting when it isn't needed.&nbsp; In my case it is heterozygous.&nbsp; This means that I have one good copy and one bad copy of the Factor V Leiden gene.&nbsp; The mutated versions of my turn off system don't match the chemical that is responsible for turning clotting off.&nbsp; I am lucky in that the other half of my turn off system is programed correctly.&nbsp; This gives me a much lower chance of having clots than if I had two mutated genes.<br /><br />Being heterozygous also gives me a hint about why I have Factor V Leiden.&nbsp; One of my parents passed on the gene to me.&nbsp; This means that at least one of my parents has either homozygous or heterozygous Factor V Leiden.<br /><br />When I was first diagnosed one of the first questions to my hematologist was, "should my family be tested?"&nbsp; My hematologist felt that my clotting condition wasn't a major risk so genetic testing wouldn't be warranted.&nbsp; He also noted that it would be helpful to let family members know that they may be at risk.<br /><br />While informing my family about the risk we discovered that someone on my mom's side also has Factor V Leiden.&nbsp; This seemed to be the missing link.&nbsp; We assumed that my mother was the carrier that gave me my gene.<br /><br />Fast forward a few years...<br /><br />This last&nbsp;fall my dad had to go in for hernia repair surgery.&nbsp; Knowing my history he shared our family history of pulmonary embolisms and my Factor V Leiden diagnosis.&nbsp; Arrangements were made to test him for Factor V Leiden.&nbsp; We expected it to be negative due to history on my mom's side.&nbsp; The tests came back positive.&nbsp; He also has heterozygous Factor V Leiden.&nbsp; Arrangements were made to consult with a hematologist and make clotting plans for his surgery.&nbsp; His hematologist, the same one that I see, cleared him for surgery with no anticoagulants as he felt that laparoscopic hernia repair was a very low risk surgery.<br /><br />Come&nbsp;May we discovered that my mom had a number of benign tumors that needed to be removed.&nbsp; Due to the history she also asked for a Factor V Leiden test.&nbsp; Her test came back negative.&nbsp; Despite that her surgeon has her on Lovenox injections.&nbsp; Abdominal surgery is a very high risk for clotting in ALL people.&nbsp; New standards for clot prevention are demanding that preventative anticoagulation be used after high risk surgeries.&nbsp; While in recovery her heart rate was up.&nbsp; As an additional precaution she was sent to have a chest CT to make sure that she didn't have clots.&nbsp; She was clear.&nbsp; We now need to make it through recovery with no clots.&nbsp; I am hoping that her lack of FVL diagnosis and the daily Lovenox injections keep her clot free.<br /><br />If&nbsp;you would like more information about who should be tested for thrombophilia please see this <a title="" href="http://patientblog.clotconnect.org/2010/11/19/thrombophilia-testing-%e2%80%93-who-should-be-tested/" target="_blank">Clot Connect article.</a><br /></span></span></span></span></div> <hr style="width:100%;clear:both;visibility:hidden;"></hr>]]></content:encoded></item><item><title><![CDATA[From Patient To Survivor]]></title><link><![CDATA[http://www.clotspot.com/articles/from-patient-to-survivor]]></link><comments><![CDATA[http://www.clotspot.com/articles/from-patient-to-survivor#comments]]></comments><pubDate>Tue, 22 Jul 2014 02:36:59 GMT</pubDate><category><![CDATA[recovery]]></category><guid isPermaLink="false">http://www.clotspot.com/articles/from-patient-to-survivor</guid><description><![CDATA[July 18, 2008, my parents&apos; anniversary, I went into the emergency room seeking answers for weeks of symptoms. A stunned ER team let me know that despite &quot;presenting well&quot; my lungs were filled with clots. I was in the hospital for 11 days, off of work for close to three months, healing for two years, and on anticoagulation therapy for one year. I had a lot of survivor&apos;s guilt and a sense that I was saved for some purpose that I would never know.  It has been 6 years. It is my  [...] ]]></description><content:encoded><![CDATA[<div class="paragraph"><p dir="auto" style="margin-bottom:1px;">July 18, 2008, my parents&apos; anniversary, I went into the emergency room seeking answers for weeks of symptoms. A stunned ER team let me know that despite &quot;presenting well&quot; my lungs were filled with clots. I was in the hospital for 11 days, off of work for close to three months, healing for two years, and on anticoagulation therapy for one year. I had a lot of survivor&apos;s guilt and a sense that I was saved for some purpose that I would never know.</p> <p dir="auto" style="margin-bottom:1px;"></p> <p dir="auto" style="margin-bottom:1px;">It has been 6 years. It is my parents&apos; 44th wedding anniversary. I have confidence in my body as it got me through the unthinkable. I am strong, working, and happy. It took time to get here but here I am.</p> <p dir="auto" style="margin-bottom:1px;"></p> <p dir="auto" style="margin-bottom:1px;">I have Factor V Leiden, a history of clots, and I fly using a disability coordinator giving me special seats. I will not and cannot forget. I will embrace my strength. I no longer survive, I thrive.</p> <p dir="auto" style="margin-bottom:1px;"></p> <p dir="auto" style="margin-bottom:1px;">Happy second birthday to me and to the other PE survivors!</p> </div>  <div><div class="wsite-image wsite-image-border-thin " style="padding-top:10px;padding-bottom:10px;margin-left:0;margin-right:0;text-align:center"> <a> <img src="http://www.clotspot.com/uploads/9/0/1/9/9019259/8674460_orig.jpg" alt="Picture" style="width:100%;max-width:600px" /> </a> <div style="display:block;font-size:90%"></div> </div></div>]]></content:encoded></item><item><title><![CDATA[Useful Breathing App for iOS Free Today]]></title><link><![CDATA[http://www.clotspot.com/articles/useful-breathing-app-for-ios-free-today]]></link><comments><![CDATA[http://www.clotspot.com/articles/useful-breathing-app-for-ios-free-today#comments]]></comments><pubDate>Mon, 30 Jun 2014 16:38:16 GMT</pubDate><category><![CDATA[Apps]]></category><category><![CDATA[tips]]></category><guid isPermaLink="false">http://www.clotspot.com/articles/useful-breathing-app-for-ios-free-today</guid><description><![CDATA[I just saw that Breathing Zone is free today. It is an app that helps you to slow your breathing rate and helps you to relax. &nbsp; I use it a lot. Download it while it is free. Add comments and let me know if you like it.         [...] ]]></description><content:encoded><![CDATA[<div class="paragraph"><p dir="auto" style="margin-bottom:1px;">I just saw that <a href="http://https://itunes.apple.com/us/app/breathing-zone-relaxing-breathing/id369838631?mt=8"><span style="text-decoration:underline;">Breathing Zone</span></a> is free today. It is an app that helps you to slow your breathing rate and helps you to relax. <span class="Apple-converted-space">&nbsp; </span>I use it a lot. Download it while it is free. Add comments and let me know if you like it.</p> </div>  <div><div class="wsite-image wsite-image-border-thin " style="padding-top:10px;padding-bottom:10px;margin-left:0;margin-right:0;text-align:center"> <a> <img src="http://www.clotspot.com/uploads/9/0/1/9/9019259/2447234_orig.jpg" alt="Picture" style="width:100%;max-width:451px" /> </a> <div style="display:block;font-size:90%"></div> </div></div>]]></content:encoded></item><item><title><![CDATA[Coping With a Pulmonary Embolism - Life As a Survivor]]></title><link><![CDATA[http://www.clotspot.com/articles/coping-with-a-pulmonary-embolism-life-as-a-survivor]]></link><comments><![CDATA[http://www.clotspot.com/articles/coping-with-a-pulmonary-embolism-life-as-a-survivor#comments]]></comments><pubDate>Sun, 29 Jun 2014 03:26:01 GMT</pubDate><category><![CDATA[faq]]></category><category><![CDATA[pulmonary embolism]]></category><category><![CDATA[recovery]]></category><category><![CDATA[tips]]></category><guid isPermaLink="false">http://www.clotspot.com/articles/coping-with-a-pulmonary-embolism-life-as-a-survivor</guid><description><![CDATA[&quot;We know what is wrong. You have blood clots in your lungs.&quot; These are words that survivors come to be grateful for and to hate. As a survivor we are often thankful that we finally have a diagnosis and a treatment for symptoms that for many of us have been happening for an extended period of time. Others are thankful to simply be alive. They were the ones that collapsed and were returned to life by acts of God, fate, and medical miracles. The doctors patch us up, test us, clear us, and [...] ]]></description><content:encoded><![CDATA[<div class="paragraph"><p dir="auto" style="margin-bottom:1px;">&quot;We know what is wrong. You have blood clots in your lungs.&quot; These are words that survivors come to be grateful for and to hate. As a survivor we are often thankful that we finally have a diagnosis and a treatment for symptoms that for many of us have been happening for an extended period of time. Others are thankful to simply be alive. They were the ones that collapsed and were returned to life by acts of God, fate, and medical miracles. The doctors patch us up, test us, clear us, and send us home on anticoagulation and filled with questions.</p> <p dir="auto" style="margin-bottom:1px;"></p> <p dir="auto" style="margin-bottom:1px;">As patients we start off with many unanswered questions. Why did this happen? How long is recovery? What are these nagging symptoms? We are frustrated when we don&apos;t have answers to these questions but these questions aren&apos;t the real challenge. <span class="Apple-converted-space">&nbsp; </span>These questions will be slowly answered by hiring new doctors, asking questions over and over again, and reading materials from patient support and advocacy groups. The real questions, the ones that are truly a challenge are the ones that nobody can answer. &quot;What do I do now that I survived?&quot; &quot;Why did I survive?&quot; &quot;How do I find faith in my ability to survive?&quot;</p> <p dir="auto" style="margin-bottom:1px;"></p> <p dir="auto" style="margin-bottom:1px;">If these ruminations sound familiar you are a survivor. Know that your brain is an organ. If your brain survived your PE without any symptoms I would be in shock. Your lungs, heart, body, and brain are all affected when you have clots in your lungs. Common complications include panic disorders, depression, and anxiety. Feeling lost and/or afraid is normal and in many ways these feelings are a healthy part of your recovery.</p> <p dir="auto" style="margin-bottom:1px;"></p> <p dir="auto" style="margin-bottom:1px;">So, what to do about them? First, let your doctors know that your brain is in need of healing. You may benefit from starting some medication to ease your symptoms. Councilling may also help you to deal with surviving. I used both of these techniques to help myself heal.</p> <p dir="auto" style="margin-bottom:1px;"></p> <p dir="auto" style="margin-bottom:1px;">Here are some additional methods to assist your mind, body, and soul adapt to being a survivor:</p> <ul style="list-style:'disc outside';-webkit-padding-start:27px;padding-left:27px;"> <li dir="auto">Track your growth so you can see progress. A fitbit can do the work for you these days.</li><li dir="auto">Ask your doctors if massage or Yoga would be safe and then try them out if your medical team okays these activities.</li><li dir="auto">Try meditation. Search for &quot;The Mediation Podcast&quot; or &quot;The Meditation Oasis&quot; as both have free recorded meditations.</li><li dir="auto">Try an app called &quot;Breathing&quot; to practice deept breathing that will be calming.</li><li dir="auto">Realize your strength. You survived! You are not weak. Your body wend through the ringer and was OK. You can and will get through recovery.</li><li dir="auto">Try a support group. Www.dailystrength.org has a great one.</li></ul> </div>  <div><div class="wsite-image wsite-image-border-thin " style="padding-top:10px;padding-bottom:10px;margin-left:0;margin-right:0;text-align:center"> <a> <img src="http://www.clotspot.com/uploads/9/0/1/9/9019259/9543247_orig.jpg" alt="Picture" style="width:100%;max-width:450px" /> </a> <div style="display:block;font-size:90%">These are saguaro cacti and other fauna of the Sonoran Desert.  Let them remind you how to survive.   When the times are rough they live off water that they stored during the rainy years.  They grow in harsh conditions and are amazing plants.  The rough environment changed them into the wise old men of the desert.  Survive and thrive as the saguaro does and find your inner strength and beauty.</div> </div></div>]]></content:encoded></item></channel></rss>